Product Details

SNP ID

rs61966636

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.13:79313872 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AGTTTGCAGAATGTTAAGCTTTGCA[A/C]CAAAAAAAAAAAAAAAAGTGATAAA

Phenotype

Polymorphism

A/C, Transversion Substitution

Allele Nomenclature

Literature Links

RBM26 PubMed Links

Additional Information

For this assay, SNP(s) [rs371456582] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

RBM26

Gene Name

RNA binding motif protein 26

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286631.1	5773	Intron			NP_001273560.1
NM_001286632.1	5773	Intron			NP_001273561.1
NM_022118.4	5773	Intron			NP_071401.3
XM_005266491.4	5773	UTR 3			XP_005266548.1
XM_005266497.1	5773	UTR 3			XP_005266554.1
XM_006719857.1	5773	UTR 3			XP_006719920.1
XM_011535179.1	5773	Intron			XP_011533481.1
XM_011535180.2	5773	UTR 3			XP_011533482.1
XM_011535181.1	5773	Intron			XP_011533483.1
XM_011535182.1	5773	Intron			XP_011533484.1
XM_011535183.2	5773	UTR 3			XP_011533485.1
XM_011535184.1	5773	Intron			XP_011533486.1
XM_011535185.2	5773	UTR 3			XP_011533487.1
XM_011535186.2	5773	Intron			XP_011533488.1
XM_011535187.2	5773	UTR 3			XP_011533489.1
XM_011535188.2	5773	UTR 3			XP_011533490.1
XM_011535189.1	5773	Intron			XP_011533491.1
XM_011535190.1	5773	Intron			XP_011533492.1
XM_011535191.2	5773	UTR 3			XP_011533493.1
XM_011535192.2	5773	UTR 3			XP_011533494.1
XM_011535193.2	5773	UTR 3			XP_011533495.1
XM_011535195.1	5773	Intron			XP_011533497.1
XM_017020688.1	5773	UTR 3			XP_016876177.1
XM_017020689.1	5773	Intron			XP_016876178.1
XM_017020690.1	5773	UTR 3			XP_016876179.1
XM_017020691.1	5773	UTR 3			XP_016876180.1
XM_017020692.1	5773	UTR 3			XP_016876181.1
XM_017020693.1	5773	UTR 3			XP_016876182.1
XM_017020694.1	5773	UTR 3			XP_016876183.1
XM_017020695.1	5773	Intron			XP_016876184.1
XM_017020696.1	5773	Intron			XP_016876185.1
XM_017020697.1	5773	UTR 3			XP_016876186.1
XM_017020698.1	5773	Intron			XP_016876187.1
XM_017020699.1	5773	UTR 3			XP_016876188.1
XM_017020700.1	5773	Intron			XP_016876189.1
XM_017020701.1	5773	UTR 3			XP_016876190.1
XM_017020702.1	5773	UTR 3			XP_016876191.1
XM_017020703.1	5773	UTR 3			XP_016876192.1

View Full Product Details