Product Details
- SNP ID
-
rs61993676
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.14:100282453 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AACGGAACAACCTCTTTTTTCTACA[A/T]TGTCCATACCCGGACATGTGAGGCT
- Phenotype
-
MIM: 615064
MIM: 600013
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR6764
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs11449512] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR6764
- Gene Name
- microRNA 6764
There are no transcripts associated with this gene.
- Gene
- SLC25A29
- Gene Name
- solute carrier family 25 member 29
- Gene
- YY1
- Gene Name
- YY1 transcription factor
There are no transcripts associated with this gene.
View Full Product Details