Product Details
- SNP ID
-
rs61899178
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:60891108 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGATTCCCCCCACCCCCCCCCCCAA[A/C]CCCTAATTCTACCCCTCTACTGAGA
- Phenotype
-
MIM: 608330
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
PRPF19
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs569612801] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PRPF19
- Gene Name
- pre-mRNA processing factor 19
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_014502.4 |
1780 |
UTR 3 |
|
|
NP_055317.1 |
View Full Product Details