Product Details

SNP ID: rs72758349
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:108873298 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CAATCAGAAATGACCCATCAAGTCA[C/T]TGATTTCACTTGTGGGGATGTGCCA
Phenotype: MIM: 604303 MIM: 603722
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ACTL7A PubMed Links

Gene Details

Gene: ACTL7A
Gene Name: actin like 7A

There are no transcripts associated with this gene.

Gene: IKBKAP
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318360.1		Intron			NP_001305289.1
NM_003640.4		Intron			NP_003631.2
XM_011519136.1		Intron			XP_011517438.1
XM_011519137.1		Intron			XP_011517439.1
XM_017015238.1		Intron			XP_016870727.1

View Full Product Details