Product Details

SNP ID: rs72931491
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:83462358 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGTATTACTGCAAACAGGTGAACA[C/T]AGTAAAAACAAATGAACTTACTGCA
Phenotype: MIM: 611143 MIM: 606769 MIM: 611983
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM175A PubMed Links

Gene Details

Gene: FAM175A
Gene Name: family with sequence similarity 175 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_139076.2	1312	Intron			NP_620775.2
XM_005263280.4	1312	UTR 3			XP_005263337.1
XM_017008694.1	1312	UTR 3			XP_016864183.1

Gene: HELQ
Gene Name: helicase, POLQ-like

There are no transcripts associated with this gene.

Gene: MRPS18C
Gene Name: mitochondrial ribosomal protein S18C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001297767.1	1312	Intron			NP_001284696.1
NM_001297769.1	1312	Intron			NP_001284698.1
NM_001297770.1	1312	Intron			NP_001284699.1
NM_016067.3	1312	Intron			NP_057151.1

View Full Product Details