Product Details

SNP ID: rs73811151
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.5:179813771 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTTTCTCAAAATAAAATAAAATA[A/T]AACCTTTTGGGCAGGCATGGAAAGG
Phenotype: MIM: 604561 MIM: 601530
Polymorphism: A/T, Transversion Substitution
Allele Nomenclature
Literature Links: MGAT4B PubMed Links
Additional Information: For this assay, SNP(s) [rs201565764] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: MGAT4B
Gene Name: mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B

There are no transcripts associated with this gene.

Transcript Accession	SNP Location	SNP Type	Protein ID
NM_001142298.1	1988	Intron	NP_001135770.1
NM_001142299.1	1988	Intron	NP_001135771.1
NM_003900.4	1988	Intron	NP_003891.1
XM_011534683.2	1988	UTR 3	XP_011532985.1
XM_017010010.1	1988	Intron	XP_016865499.1