Product Details

SNP ID: rs73347918
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:57625157 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAGCCAGATGGCCCAATGGTTGCAG[G/T]TGAGATGGGGTGACAAGAAGGAAGA
Phenotype: MIM: 610215 MIM: 601873
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ARHGEF25 PubMed Links

Gene Details

Gene: ARHGEF25
Gene Name: Rho guanine nucleotide exchange factor 25

There are no transcripts associated with this gene.

Gene: B4GALNT1
Gene Name: beta-1,4-N-acetyl-galactosaminyltransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001276468.1	3651	Intron			NP_001263397.1
NM_001276469.1	3651	Intron			NP_001263398.1
NM_001478.4	3651	Intron			NP_001469.1
XM_005268773.4	3651	UTR 3			XP_005268830.1
XM_011538147.2	3651	UTR 3			XP_011536449.1
XM_011538148.2	3651	UTR 3			XP_011536450.1
XM_017019140.1	3651	UTR 3			XP_016874629.1
XM_017019141.1	3651	UTR 3			XP_016874630.1
XM_017019142.1	3651	UTR 3			XP_016874631.1

Gene: LOC101927583
Gene Name: uncharacterized LOC101927583

There are no transcripts associated with this gene.

Gene: SLC26A10
Gene Name: solute carrier family 26 member 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_133489.2	3651	Intron			NP_597996.2

View Full Product Details