Product Details

SNP ID

rs72953778

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.11:72108698 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGCAGACCTGGTGCTCCTGGCACAC[C/T]GGCCACGATGTTACCTGAGGGACCT

Phenotype

MIM: 614717 MIM: 613510 MIM: 612414

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ANAPC15 PubMed Links

Gene Details

Gene

ANAPC15

Gene Name

anaphase promoting complex subunit 15

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001278485.1	3063	Intron			NP_001265414.1
NM_001278486.1	3063	Intron			NP_001265415.1
NM_001278487.1	3063	Intron			NP_001265416.1
NM_001278488.1	3063	Intron			NP_001265417.1
NM_001278489.1	3063	Intron			NP_001265418.1
NM_001278490.1	3063	Intron			NP_001265419.1
NM_001278491.1	3063	Intron			NP_001265420.1
NM_001278492.1	3063	Intron			NP_001265421.1
NM_001278493.1	3063	Intron			NP_001265422.1
NM_001278494.1	3063	Intron			NP_001265423.1
NM_014042.2	3063	Intron			NP_054761.1
XM_017017488.1	3063	Intron			XP_016872977.1
XM_017017489.1	3063	Intron			XP_016872978.1
XM_017017490.1	3063	Intron			XP_016872979.1
XM_017017491.1	3063	Intron			XP_016872980.1
XM_017017492.1	3063	Intron			XP_016872981.1
XM_017017493.1	3063	Intron			XP_016872982.1
XM_017017494.1	3063	Intron			XP_016872983.1
XM_017017495.1	3063	Intron			XP_016872984.1
XM_017017496.1	3063	Intron			XP_016872985.1
XM_017017497.1	3063	Intron			XP_016872986.1

Gene

LAMTOR1

Gene Name

late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

There are no transcripts associated with this gene.

Gene

LRTOMT

Gene Name

leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4	3063	Intron			NP_001138779.1
NM_001145308.4	3063	Missense Mutation	CGG,TGG	R217W	NP_001138780.1
NM_001145309.3	3063	Missense Mutation	CGG,TGG	R217W	NP_001138781.1
NM_001145310.3	3063	Missense Mutation	CGG,TGG	R177W	NP_001138782.1
NM_001205138.3	3063	Intron			NP_001192067.1
NM_001271471.2	3063	Intron			NP_001258400.1
NM_001318803.1	3063	Intron			NP_001305732.1
NM_145309.5	3063	Intron			NP_660352.1
XM_006718473.3	3063	Intron			XP_006718536.1
XM_006718474.3	3063	Intron			XP_006718537.1
XM_011544847.2	3063	Intron			XP_011543149.1
XM_011544848.2	3063	Intron			XP_011543150.1
XM_017017356.1	3063	Missense Mutation	CGG,TGG	R184W	XP_016872845.1
XM_017017357.1	3063	Missense Mutation	CGG,TGG	R184W	XP_016872846.1
XM_017017358.1	3063	Missense Mutation	CGG,TGG	R184W	XP_016872847.1
XM_017017359.1	3063	Intron			XP_016872848.1
XM_017017360.1	3063	Intron			XP_016872849.1

View Full Product Details