Product Details

SNP ID: rs73534053
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:70862815 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTTGGATCCTTTGGGATTCCCCCA[A/C]GGGAGTAGTCAACTGGGCAGCAGGA
Phenotype: MIM: 603290
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: MIR3664 PubMed Links

Gene Details

Gene: MIR3664
Gene Name: microRNA 3664

There are no transcripts associated with this gene.

Gene: SHANK2
Gene Name: SH3 and multiple ankyrin repeat domains 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_012309.4		Intron			NP_036441.2
NM_133266.4		Intron			NP_573573.2
XM_005277932.3		Intron			XP_005277989.1
XM_017017387.1		Intron			XP_016872876.1
XM_017017388.1		Intron			XP_016872877.1
XM_017017389.1		Intron			XP_016872878.1
XM_017017390.1		Intron			XP_016872879.1

Gene: SHANK2-AS3
Gene Name: SHANK2 antisense RNA 3

There are no transcripts associated with this gene.

View Full Product Details