Product Details

SNP ID: rs66913836
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.13:113760418 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GAATGCCTTAATGTTTAAAAATAGC[A/C]TCTGACTTAGATTTTCTTCTGACAA
Phenotype
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LINC00552 PubMed Links

Gene Details

Gene: LINC00552
Gene Name: long intergenic non-protein coding RNA 552

There are no transcripts associated with this gene.

Gene: LOC105377805
Gene Name: basic salivary proline-rich protein 4-like

There are no transcripts associated with this gene.

Gene: TMEM255B
Gene Name: transmembrane protein 255B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182614.2		Intron			NP_872420.1
XM_005272413.3		Intron			XP_005272470.1
XM_005272415.2		Intron			XP_005272472.1
XM_006719986.2		Intron			XP_006720049.1
XM_017020558.1		Intron			XP_016876047.1
XM_017020559.1		Intron			XP_016876048.1
XM_017020560.1		Intron			XP_016876049.1

View Full Product Details