Product Details

SNP ID: rs74968977
Assay Type: Functionally tested
NCBI dbSNP Submissions: 5
Location: Chr.1:150276557 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATAAGGACATAACAGAAGCAATAGA[C/G]ACTACCATTAGTCTTGAAACAGCAC
Phenotype: MIM: 607629 MIM: 615782
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: APH1A PubMed Links

Gene Details

Gene: APH1A
Gene Name: aph-1 homolog A, gamma-secretase subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077628.2	374	Intron			NP_001071096.1
NM_001243771.1	374	Intron			NP_001230700.1
NM_001243772.1	374	Intron			NP_001230701.1
NM_016022.3	374	Intron			NP_057106.2
XM_017001417.1	374	Intron			XP_016856906.1

Gene: C1orf54
Gene Name: chromosome 1 open reading frame 54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001301039.1	374	Missense Mutation	GAC,GAG	D75E	NP_001287968.1
NM_001301040.1	374	Missense Mutation	GAC,GAG	D75E	NP_001287969.1
NM_001301041.1	374	Missense Mutation	GAC,GAG	D47E	NP_001287970.1
NM_001301042.1	374	Missense Mutation	GAC,GAG	D75E	NP_001287971.1
NM_024579.3	374	Missense Mutation	GAC,GAG	D75E	NP_078855.2
XM_011509984.2	374	Missense Mutation	GAC,GAG	D47E	XP_011508286.1

Gene: CIART
Gene Name: circadian associated repressor of transcription

There are no transcripts associated with this gene.

View Full Product Details