Product Details

SNP ID: rs80098484
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219238082 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AATGTAGCCATCTATCACCCATCTA[G/T]TCTAGAATTCTATCCTTAATCAAAC
Phenotype: MIM: 612204 MIM: 604719
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: ANKZF1 PubMed Links

Gene Details

Gene: ANKZF1
Gene Name: ankyrin repeat and zinc finger domain containing 1

There are no transcripts associated with this gene.

Gene: ATG9A
Gene Name: autophagy related 9A

There are no transcripts associated with this gene.

Gene: GLB1L
Gene Name: galactosidase beta 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286423.1		Intron			NP_001273352.1
NM_001286427.1		Intron			NP_001273356.1
NM_024506.4		Intron			NP_078782.3
XM_011511813.2		Intron			XP_011510115.1
XM_017004895.1		Intron			XP_016860384.1

Gene: STK16
Gene Name: serine/threonine kinase 16

There are no transcripts associated with this gene.

View Full Product Details