Product Details
- SNP ID
-
rs734380
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:58387596 on Build GRCh38
- Set Membership
-
HapMap
- Context Sequence [VIC/FAM]
- TCTGAGATAGGAAGTTTCCATTTCT[G/T]AGGGACACGATGCCCTCTTTTGCTC
- Phenotype
-
MIM: 603630
- Polymorphism
- G/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
MIR4754
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs116550221] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- MIR4754
- Gene Name
- microRNA 4754
There are no transcripts associated with this gene.
- Gene
- RNF225
- Gene Name
- ring finger protein 225
There are no transcripts associated with this gene.
- Gene
- RPS5
- Gene Name
- ribosomal protein S5
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_001009.3 |
|
Intron |
|
|
NP_001000.2 |
- Gene
- ZNF837
- Gene Name
- zinc finger protein 837
There are no transcripts associated with this gene.
View Full Product Details