Product Details

SNP ID
rs1045926
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.3:56620572 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
TCATGTACCAATACCCTCTGCATTT[C/G]AAAATGTTGACTCAGATGTTTTTCC
Phenotype
MIM: 616493
Polymorphism
C/G, Transversion Substitution
Allele Nomenclature
Literature Links
CCDC66 PubMed Links
Additional Information
For this assay, SNP(s) [rs534538641] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
CCDC66
Gene Name
coiled-coil domain containing 66
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001012506.4 6807 Intron NP_001012524.4
NM_001141947.1 6807 Intron NP_001135419.1
XM_005265081.3 6807 Intron XP_005265138.1
XM_005265082.3 6807 Intron XP_005265139.1
XM_005265083.3 6807 Intron XP_005265140.1
XM_005265084.3 6807 Intron XP_005265141.1
XM_011533614.2 6807 Intron XP_011531916.1
XM_011533615.2 6807 Intron XP_011531917.1
XM_011533616.2 6807 Intron XP_011531918.1
XM_011533617.2 6807 Intron XP_011531919.1
XM_011533619.2 6807 Intron XP_011531921.1
XM_017006229.1 6807 Intron XP_016861718.1
XM_017006230.1 6807 Intron XP_016861719.1
XM_017006231.1 6807 Intron XP_016861720.1
XM_017006232.1 6807 Intron XP_016861721.1
XM_017006233.1 6807 Intron XP_016861722.1
XM_017006234.1 6807 Intron XP_016861723.1
XM_017006235.1 6807 Intron XP_016861724.1
XM_017006236.1 6807 Intron XP_016861725.1
XM_017006237.1 6807 Intron XP_016861726.1
XM_017006238.1 6807 Intron XP_016861727.1
XM_017006239.1 6807 Intron XP_016861728.1
XM_017006240.1 6807 Intron XP_016861729.1
XM_017006241.1 6807 Intron XP_016861730.1
XM_017006242.1 6807 Intron XP_016861731.1
XM_017006243.1 6807 Intron XP_016861732.1
XM_017006244.1 6807 Intron XP_016861733.1
XM_017006245.1 6807 Intron XP_016861734.1
Gene
FAM208A
Gene Name
family with sequence similarity 208 member A
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001112736.1 6807 UTR 3 NP_001106207.1
NM_015224.3 6807 UTR 3 NP_056039.2
XM_005264999.1 6807 UTR 3 XP_005265056.1
XM_006713077.2 6807 Intron XP_006713140.1
XM_006713078.2 6807 Intron XP_006713141.1
XM_011533552.2 6807 Intron XP_011531854.1
XM_011533553.2 6807 Intron XP_011531855.1
XM_017006030.1 6807 Intron XP_016861519.1
XM_017006031.1 6807 Intron XP_016861520.1
XM_017006032.1 6807 Intron XP_016861521.1

View Full Product Details