Product Details

SNP ID: rs835873
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.20:4222155 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CCTGTAGGGAGCAGAGACCGATACT[A/G]TTTAGCTGCTTGGGGAGGGGGAGGC
Phenotype: MIM: 104219
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: ADRA1D PubMed Links
Additional Information: For this assay, SNP(s) [rs58789310] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000678.3		Intron			NP_000669.1