Product Details

SNP ID: rs11730088
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:15682345 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CAGGAAGGTATCCAGCCTTAAAGAT[C/G]CTTTTTTTAAATAGACGATTTTAGA
Phenotype: MIM: 600387 MIM: 605655
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: BST1 PubMed Links

Gene Details

Gene: BST1
Gene Name: bone marrow stromal cell antigen 1

There are no transcripts associated with this gene.

Gene: FAM200B
Gene Name: family with sequence similarity 200 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145191.1		Intron			NP_001138663.1
XM_017008048.1		Intron			XP_016863537.1

Gene: FBXL5
Gene Name: F-box and leucine rich repeat protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193534.1		Intron			NP_001180463.1
NM_001193535.1		Intron			NP_001180464.1
NM_012161.3		Intron			NP_036293.1
XM_006713959.3		Intron			XP_006714022.1
XM_011513831.2		Intron			XP_011512133.1
XM_011513832.2		Intron			XP_011512134.1
XM_011513833.2		Intron			XP_011512135.1
XM_017008019.1		Intron			XP_016863508.1

View Full Product Details