Product Details

SNP ID: rs10891704
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:114569615 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCACATGAGACCCAGAGAGCTGAAG[A/T]TACTTATCCAGTCTTTTGTTGTTGT
Phenotype
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: NXPE1 PubMed Links

Gene Details

Gene: NXPE1
Gene Name: neurexophilin and PC-esterase domain family member 1

There are no transcripts associated with this gene.

Gene: NXPE2
Gene Name: neurexophilin and PC-esterase domain family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182495.5		Intron			NP_872301.2
XM_011542604.2		Intron			XP_011540906.1
XM_017017206.1		Intron			XP_016872695.1
XM_017017207.1		Intron			XP_016872696.1
XM_017017208.1		Intron			XP_016872697.1
XM_017017209.1		Intron			XP_016872698.1
XM_017017210.1		Intron			XP_016872699.1
XM_017017211.1		Intron			XP_016872700.1
XM_017017212.1		Intron			XP_016872701.1

Gene: NXPE4
Gene Name: neurexophilin and PC-esterase domain family member 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077639.1		Intron			NP_001071107.1
NM_017678.2		Intron			NP_060148.2
XM_006718865.3		Intron			XP_006718928.1
XM_011542881.2		Intron			XP_011541183.1
XM_011542882.2		Intron			XP_011541184.1
XM_011542883.2		Intron			XP_011541185.1

View Full Product Details