Product Details

SNP ID: rs876874
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:90998505 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCAGCCATCTCCCTCATTTTATGGT[A/T]GAGGAAACTCAGGTACAGAGTGGTA
Phenotype: MIM: 603484 MIM: 608552
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: PRC1 PubMed Links

Gene Details

Gene: PRC1
Gene Name: protein regulator of cytokinesis 1

There are no transcripts associated with this gene.

Gene: PRC1-AS1
Gene Name: PRC1 antisense RNA 1

There are no transcripts associated with this gene.

Gene: VPS33B
Gene Name: VPS33B, late endosome and lysosome associated

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289148.1	2615	UTR 3			NP_001276077.1
NM_001289149.1	2615	UTR 3			NP_001276078.1
NM_018668.4	2615	UTR 3			NP_061138.3
XM_005254887.1	2615	Intron			XP_005254944.1
XM_011521448.1	2615	Intron			XP_011519750.1
XM_011521449.2	2615	Intron			XP_011519751.1
XM_017022075.1	2615	Intron			XP_016877564.1
XM_017022076.1	2615	Intron			XP_016877565.1

View Full Product Details