Product Details

SNP ID: rs3744036
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:76145404 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGAGCCAGACCTTTGGCCAAATCC[A/T]GATGGTGTCTCCAGCAGGGCAGCCC
Phenotype: MIM: 602291
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: FOXJ1 PubMed Links

Gene Details

Gene: FOXJ1
Gene Name: forkhead box J1

There are no transcripts associated with this gene.

Gene: RNF157
Gene Name: ring finger protein 157

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052916.2		Intron			NP_443148.1
XM_005257007.4		Intron			XP_005257064.1
XM_011524273.2		Intron			XP_011522575.1
XM_017024117.1		Intron			XP_016879606.1
XM_017024118.1		Intron			XP_016879607.1
XM_017024119.1		Intron			XP_016879608.1
XM_017024120.1		Intron			XP_016879609.1

Gene: RNF157-AS1
Gene Name: RNF157 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details