Product Details

SNP ID: rs3793137
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:39904728 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCGACTTCTACCAGGGATGCCTTCA[A/C]GCCAAGGCTGTTCTCACCAGCTGCC
Phenotype: MIM: 606627 MIM: 603707
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: DAAM2 PubMed Links

Gene Details

Gene: DAAM2
Gene Name: dishevelled associated activator of morphogenesis 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001201427.1	3537	UTR 3			NP_001188356.1
NM_015345.3	3537	UTR 3			NP_056160.2
XM_006715039.3	3537	UTR 3			XP_006715102.3
XM_006715040.3	3537	Intron			XP_006715103.3
XM_006715042.2	3537	UTR 3			XP_006715105.1
XM_006715043.2	3537	UTR 3			XP_006715106.1
XM_006715045.3	3537	UTR 3			XP_006715108.1
XM_006715046.3	3537	UTR 3			XP_006715109.1
XM_017010630.1	3537	UTR 3			XP_016866119.1

Gene: LOC100505635
Gene Name: uncharacterized LOC100505635

There are no transcripts associated with this gene.

Gene: MOCS1
Gene Name: molybdenum cofactor synthesis 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001075098.3	3537	UTR 3			NP_001068566.1
NM_005943.5	3537	UTR 3			NP_005934.2
XM_011514632.2	3537	Intron			XP_011512934.1
XM_011514633.2	3537	UTR 3			XP_011512935.1
XM_011514634.2	3537	Intron			XP_011512936.1
XM_017010888.1	3537	UTR 3			XP_016866377.1

View Full Product Details