Product Details

SNP ID: rs1053363
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:7682559 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGAAGGCGCTCTTCGGCAAGGAGGC[A/G]GACAAGCTGGAGCAGGCCAACGATG
Phenotype: MIM: 151445 MIM: 609565
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FCER2 PubMed Links

Gene Details

Gene: FCER2
Gene Name: Fc fragment of IgE receptor II

There are no transcripts associated with this gene.

Gene: MCEMP1
Gene Name: mast cell expressed membrane protein 1

There are no transcripts associated with this gene.

Gene: TRAPPC5
Gene Name: trafficking protein particle complex 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001042461.2	376	Silent Mutation	GCA,GCG	A102A	NP_001035926.1
NM_001042462.1	376	Silent Mutation	GCA,GCG	A102A	NP_001035927.1
NM_174894.2	376	Silent Mutation	GCA,GCG	A102A	NP_777554.1

View Full Product Details