Product Details

SNP ID: rs3762840
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:121825441 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATCAGTTTTCTTATATGATTTGACA[A/T]ATTTTACAACAGTTGTGAAGATCAA
Phenotype: MIM: 607590 MIM: 123835 MIM: 606180
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: BBS7 PubMed Links

Gene Details

Gene: BBS7
Gene Name: Bardet-Biedl syndrome 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018190.3	2751	Intron			NP_060660.2
NM_176824.2	2751	UTR 3			NP_789794.1
XM_005263106.3	2751	UTR 3			XP_005263163.1
XM_011532079.2	2751	UTR 3			XP_011530381.1
XM_011532080.2	2751	UTR 3			XP_011530382.1
XM_011532081.2	2751	UTR 3			XP_011530383.1
XM_017008357.1	2751	UTR 3			XP_016863846.1
XM_017008358.1	2751	UTR 3			XP_016863847.1

Gene: CCNA2
Gene Name: cyclin A2

There are no transcripts associated with this gene.

Gene: EXOSC9
Gene Name: exosome component 9

There are no transcripts associated with this gene.

View Full Product Details