Product Details

SNP ID
rs9525471
Assay Type
Validated
NCBI dbSNP Submissions
NA
Location
Chr.13:41312432 on Build GRCh38
Set Membership
Validated
Context Sequence [VIC/FAM]
GTGCCAGCGTCCCTGGTAGCTTTCC[A/G]GGTTCTGTTCTTCCAAGGAGAAGAG
Phenotype
MIM: 604601
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
MTRF1 PubMed Links
Additional Information
For this assay, SNP(s) [rs2483099] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
MTRF1
Gene Name
mitochondrial translational release factor 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_004294.2 Intron NP_004285.2
XM_005266599.2 Intron XP_005266656.1
XM_006719897.2 Intron XP_006719960.1
XM_006719898.2 Intron XP_006719961.1
XM_006719900.2 Intron XP_006719963.1
XM_011535315.2 Intron XP_011533617.1
XM_011535317.2 Intron XP_011533619.1
XM_011535318.2 Intron XP_011533620.1
XM_011535320.2 Intron XP_011533622.1
XM_011535321.2 Intron XP_011533623.1
XM_011535323.2 Intron XP_011533625.1
XM_011535325.2 Intron XP_011533627.1
XM_011535326.2 Intron XP_011533628.1
XM_011535327.2 Intron XP_011533629.1
XM_017020856.1 Intron XP_016876345.1
XM_017020857.1 Intron XP_016876346.1
XM_017020858.1 Intron XP_016876347.1
XM_017020859.1 Intron XP_016876348.1
XM_017020860.1 Intron XP_016876349.1
XM_017020861.1 Intron XP_016876350.1
XM_017020862.1 Intron XP_016876351.1
XM_017020863.1 Intron XP_016876352.1
XM_017020864.1 Intron XP_016876353.1
XM_017020865.1 Intron XP_016876354.1
XM_017020866.1 Intron XP_016876355.1
XM_017020867.1 Intron XP_016876356.1
XM_017020868.1 Intron XP_016876357.1
XM_017020869.1 Intron XP_016876358.1
XM_017020870.1 Intron XP_016876359.1
XM_017020871.1 Intron XP_016876360.1
XM_017020872.1 Intron XP_016876361.1
XM_017020873.1 Intron XP_016876362.1
XM_017020874.1 Intron XP_016876363.1
XM_017020875.1 Intron XP_016876364.1
XM_017020876.1 Intron XP_016876365.1
XM_017020877.1 Intron XP_016876366.1
XM_017020878.1 Intron XP_016876367.1
XM_017020879.1 Intron XP_016876368.1
Gene
NAA16
Gene Name
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001110798.1 Intron NP_001104268.1
NM_018527.3 Intron NP_060997.2
NM_024561.4 Intron NP_078837.3
XM_005266523.2 Intron XP_005266580.1
XM_006719866.2 Intron XP_006719929.1
XM_011535227.2 Intron XP_011533529.1
XM_011535228.1 Intron XP_011533530.1
XM_017020744.1 Intron XP_016876233.1
XM_017020745.1 Intron XP_016876234.1
XM_017020746.1 Intron XP_016876235.1

View Full Product Details