Product Details

SNP ID: rs11807724
Assay Type: Functionally tested
NCBI dbSNP Submissions: 14
Location: Chr.1:206470248 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGCTCCAGTGAACTGTGGGAGATG[C/T]CAAAACAGCACCCAGCTGCCCATCA
Phenotype: MIM: 605048 MIM: 606524
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: IKBKE PubMed Links

Gene Details

Gene: IKBKE
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193321.1	6	UTR 5			NP_001180250.1
NM_001193322.1	6	UTR 5			NP_001180251.1
NM_014002.3	6	UTR 5			NP_054721.1
XM_005273356.2	6	UTR 5			XP_005273413.1
XM_017002868.1	6	UTR 5			XP_016858357.1

Gene: MIR6769B
Gene Name: microRNA 6769b

There are no transcripts associated with this gene.

Gene: SRGAP2
Gene Name: SLIT-ROBO Rho GTPase activating protein 2

There are no transcripts associated with this gene.

View Full Product Details