Product Details

SNP ID: rs9383139
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.6:16240698 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: GGGAATACTATCACATCATGCGACA[A/C]TGTCATGCAACACTTGGCTTCATAA
Phenotype: MIM: 139265
Polymorphism: A/C, Transversion Substitution
Allele Nomenclature
Literature Links: GMPR PubMed Links
Additional Information: For this assay, SNP(s) [rs74291715] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006877.3		Intron			NP_006868.3
XM_011514508.2		Intron			XP_011512810.1