Product Details

SNP ID: rs712665
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:112892102 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCAGGCTGAAAATGATTTAGAAAAT[A/G]GTACCACATGGCAAAACCCAGAACC
Phenotype: MIM: 125265 MIM: 182175 MIM: 601079
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: REEP5 PubMed Links

Gene Details

Gene: REEP5
Gene Name: receptor accessory protein 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005669.4	990	Intron			NP_005660.4
XM_017009844.1	990	Intron			XP_016865333.1

Gene: SRP19
Gene Name: signal recognition particle 19

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204193.1	990	Intron			NP_001191122.1
NM_001204194.1	990	Intron			NP_001191123.1
NM_001204196.1	990	Intron			NP_001191125.1
NM_001204199.1	990	UTR 3			NP_001191128.1
NM_003135.2	990	Intron			NP_003126.1

Gene: ZRSR1
Gene Name: zinc finger CCCH-type, RNA binding motif and serine/arginine rich 1

There are no transcripts associated with this gene.

View Full Product Details