Product Details

SNP ID
rs36056848
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.8:103501167 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
CCCAGTTCGCCGCCCTCCCTCCCGC[C/T]GGCGGCGCCCAGGCCACGAGGGCTG
Phenotype
MIM: 606630
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
RIMS2 PubMed Links
Additional Information
For this assay, SNP(s) [rs185087587] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
RIMS2
Gene Name
regulating synaptic membrane exocytosis 2
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001100117.2 Intron NP_001093587.1
NM_001282881.1 Intron NP_001269810.1
NM_001282882.1 Intron NP_001269811.1
NM_014677.4 Intron NP_055492.3
XM_005251106.3 Intron XP_005251163.1
XM_005251107.3 Intron XP_005251164.1
XM_006716698.3 Intron XP_006716761.1
XM_011517395.2 Intron XP_011515697.1
XM_011517398.2 Intron XP_011515700.1
XM_017014006.1 Intron XP_016869495.1
XM_017014007.1 Intron XP_016869496.1
XM_017014008.1 Intron XP_016869497.1
XM_017014009.1 Intron XP_016869498.1
XM_017014010.1 Intron XP_016869499.1
XM_017014011.1 Intron XP_016869500.1
XM_017014012.1 Intron XP_016869501.1
XM_017014013.1 Intron XP_016869502.1
XM_017014014.1 Intron XP_016869503.1
XM_017014015.1 Intron XP_016869504.1
XM_017014016.1 Intron XP_016869505.1
XM_017014017.1 Intron XP_016869506.1
XM_017014018.1 Intron XP_016869507.1
XM_017014019.1 Intron XP_016869508.1
XM_017014020.1 Intron XP_016869509.1
XM_017014021.1 Intron XP_016869510.1
XM_017014022.1 Intron XP_016869511.1
XM_017014023.1 Intron XP_016869512.1
XM_017014024.1 Intron XP_016869513.1
XM_017014025.1 Intron XP_016869514.1
XM_017014026.1 Intron XP_016869515.1
XM_017014027.1 Intron XP_016869516.1
XM_017014028.1 Intron XP_016869517.1
XM_017014029.1 Intron XP_016869518.1
XM_017014030.1 Intron XP_016869519.1
XM_017014031.1 Intron XP_016869520.1
XM_017014032.1 Intron XP_016869521.1
XM_017014033.1 Intron XP_016869522.1
XM_017014034.1 Intron XP_016869523.1
XM_017014035.1 Intron XP_016869524.1
XM_017014036.1 Intron XP_016869525.1
XM_017014037.1 Intron XP_016869526.1
XM_017014038.1 Intron XP_016869527.1
XM_017014039.1 Intron XP_016869528.1
XM_017014040.1 Intron XP_016869529.1
XM_017014041.1 Intron XP_016869530.1
XM_017014042.1 Intron XP_016869531.1
XM_017014043.1 Intron XP_016869532.1
XM_017014044.1 Intron XP_016869533.1
XM_017014045.1 Intron XP_016869534.1
XM_017014046.1 Intron XP_016869535.1

View Full Product Details