Product Details

SNP ID: rs12470957
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:85546129 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CATGGAGACTTAAAAACTTGGAAAT[C/T]TGGAGGCCAGGCGGAGTGGCCTGTA
Phenotype: MIM: 137167 MIM: 601468 MIM: 616350
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GGCX PubMed Links

Gene Details

Gene: GGCX
Gene Name: gamma-glutamyl carboxylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000821.6	6188	UTR 3			NP_000812.2
NM_001142269.3	6188	UTR 3			NP_001135741.1
NM_001311312.1	6188	Intron			NP_001298241.1
XM_005264259.4	6188	Intron			XP_005264316.1
XM_011532764.2	6188	Intron			XP_011531066.1
XM_011532765.2	6188	Intron			XP_011531067.1
XM_017003803.1	6188	Intron			XP_016859292.1

Gene: MAT2A
Gene Name: methionine adenosyltransferase 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005911.5	6188	Intron			NP_005902.1

Gene: PARTICL
Gene Name: promoter of MAT2A antisense radiation-induced circulating long non-coding RNA

There are no transcripts associated with this gene.

View Full Product Details