Product Details

SNP ID: rs34889005
Assay Type: Functionally Tested
NCBI dbSNP Submissions: 15
Location: Chr.1:228495601 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTGCACACCTGTGATGCTTGCCC[A/G]GACAGGTCCTGATGGCAGAGTCTCC
Phenotype: MIM: 613754
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: RNF187 PubMed Links
Additional Information: For this assay, SNP(s) [rs116719747] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001010858.2	2546	UTR 3			NP_001010858.2