Product Details

SNP ID

rs226504

Assay Type

Validated

NCBI dbSNP Submissions

NA

Location

Chr.22:45309502 on Build GRCh38

Set Membership

HapMap Validated

Context Sequence [VIC/FAM]

GACGGAGACCAGCCTCAGGTCTGGG[A/T]TGGGGACAGAAGCTGTGCCTAAGTG

Phenotype

Polymorphism

A/T, Transversion Substitution

Allele Nomenclature

Literature Links

FAM118A PubMed Links

Additional Information

For this assay, SNP(s) [rs12167555] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

FAM118A

Gene Name

family with sequence similarity 118 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001104595.1	303	UTR 5			NP_001098065.1
NM_017911.2	303	Intron			NP_060381.2
XM_011530247.2	303	Intron			XP_011528549.1
XM_011530254.2	303	Intron			XP_011528556.1
XM_011530256.1	303	Intron			XP_011528558.1
XM_017028841.1	303	Intron			XP_016884330.1
XM_017028842.1	303	Intron			XP_016884331.1
XM_017028843.1	303	Intron			XP_016884332.1
XM_017028844.1	303	Intron			XP_016884333.1
XM_017028845.1	303	Intron			XP_016884334.1
XM_017028846.1	303	Intron			XP_016884335.1
XM_017028847.1	303	Intron			XP_016884336.1
XM_017028848.1	303	Intron			XP_016884337.1
XM_017028849.1	303	Intron			XP_016884338.1
XM_017028850.1	303	Intron			XP_016884339.1
XM_017028851.1	303	Intron			XP_016884340.1
XM_017028852.1	303	Intron			XP_016884341.1
XM_017028853.1	303	Intron			XP_016884342.1
XM_017028854.1	303	Intron			XP_016884343.1
XM_017028855.1	303	Intron			XP_016884344.1
XM_017028856.1	303	Intron			XP_016884345.1
XM_017028857.1	303	Intron			XP_016884346.1
XM_017028858.1	303	Intron			XP_016884347.1
XM_017028859.1	303	Intron			XP_016884348.1
XM_017028860.1	303	Intron			XP_016884349.1
XM_017028861.1	303	Intron			XP_016884350.1

View Full Product Details