Product Details

SNP ID: rs397522
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:45704006 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACTCATTCTTCCTGTACACAAATAA[C/T]CCATGTTAGGTTAACCCCAGGGTAA
Phenotype
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MIR3617 PubMed Links

Gene Details

Gene: MIR3617
Gene Name: microRNA 3617

There are no transcripts associated with this gene.

Gene: WFDC10B
Gene Name: WAP four-disulfide core domain 10B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172006.2		Intron			NP_742003.1
NM_172131.2		Intron			NP_742143.1
XM_017027824.1		Intron			XP_016883313.1
XM_017027825.1		Intron			XP_016883314.1

Gene: WFDC13
Gene Name: WAP four-disulfide core domain 13

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172005.1		Intron			NP_742002.1

Gene: WFDC3
Gene Name: WAP four-disulfide core domain 3

There are no transcripts associated with this gene.

View Full Product Details