Product Details

SNP ID: rs752974
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.10:101002499 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGACACCACTGCCCTGCTTACAGGT[C/T]GCCTGCGAGGCCGCTGGCCAGGCCT
Phenotype: MIM: 606075 MIM: 610454 MIM: 612971
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C10orf2 PubMed Links

Gene Details

Gene: C10orf2
Gene Name: chromosome 10 open reading frame 2

There are no transcripts associated with this gene.

Gene: LZTS2
Gene Name: leucine zipper tumor suppressor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318099.1	173	UTR 5			NP_001305028.1
NM_001318100.1	173	UTR 5			NP_001305029.1
NM_001318101.1	173	UTR 5			NP_001305030.1
NM_032429.3	173	UTR 5			NP_115805.1
XM_005270222.4	173	UTR 5			XP_005270279.1
XM_017016780.1	173	UTR 5			XP_016872269.1
XM_017016781.1	173	UTR 5			XP_016872270.1

Gene: PDZD7
Gene Name: PDZ domain containing 7

There are no transcripts associated with this gene.

View Full Product Details