Product Details

SNP ID: rs33676
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:36155989 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGATCTTCCTCCTTCCACTCAGCAA[A/G]AAAGGAGATTCTGAGGAAAGAGAGG
Phenotype: MIM: 601436
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LMBRD2 PubMed Links

Gene Details

Gene: LMBRD2
Gene Name: LMBR1 domain containing 2

There are no transcripts associated with this gene.

Gene: MIR580
Gene Name: microRNA 580

There are no transcripts associated with this gene.

Gene: SKP2
Gene Name: S-phase kinase-associated protein 2, E3 ubiquitin protein ligase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243120.1		Intron			NP_001230049.1
NM_005983.3		Intron			NP_005974.2
NM_032637.3		Intron			NP_116026.1
XM_011514081.2		Intron			XP_011512383.1
XM_011514082.2		Intron			XP_011512384.1
XM_011514083.2		Intron			XP_011512385.1
XM_017009753.1		Intron			XP_016865242.1

View Full Product Details