Product Details

SNP ID: rs5960905
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:57126526 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGGAGAGTGAACCTGAAAGGATAT[A/G]AGGATTAAGCTGCTGTATTCAGCTT
Phenotype: MIM: 300654 MIM: 300621 MIM: 300517
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FAAH2 PubMed Links

Gene Details

Gene: FAAH2
Gene Name: fatty acid amide hydrolase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_174912.3		Intron			NP_777572.2
XM_005261982.1		Intron			XP_005262039.1
XM_005261985.2		Intron			XP_005262042.1
XM_005261986.3		Intron			XP_005262043.1
XM_005261987.3		Intron			XP_005262044.1
XM_011530767.2		Intron			XP_011529069.1
XM_017029290.1		Intron			XP_016884779.1
XM_017029291.1		Intron			XP_016884780.1
XM_017029292.1		Intron			XP_016884781.1
XM_017029293.1		Intron			XP_016884782.1
XM_017029294.1		Intron			XP_016884783.1

Gene: SPIN2A
Gene Name: spindlin family member 2A

There are no transcripts associated with this gene.

Gene: SPIN2B
Gene Name: spindlin family member 2B

There are no transcripts associated with this gene.

View Full Product Details