Product Details

SNP ID

rs14034

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.22:31619420 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GAACGGGATAGGTTGAGGGGCATGA[C/T]GGGGGCTCTCGCCACCTCTTGTCTG

Phenotype

MIM: 612770 MIM: 612765

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

MIR7109 PubMed Links

Additional Information

For this assay, SNP(s) [rs142338374] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

MIR7109

Gene Name

microRNA 7109

There are no transcripts associated with this gene.

Gene

PISD

Gene Name

phosphatidylserine decarboxylase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001326411.1	1659	UTR 3			NP_001313340.1
NM_001326412.1	1659	UTR 3			NP_001313341.1
NM_001326413.1	1659	UTR 3			NP_001313342.1
NM_001326414.1	1659	UTR 3			NP_001313343.1
NM_001326415.1	1659	UTR 3			NP_001313344.1
NM_001326416.1	1659	UTR 3			NP_001313345.1
NM_001326417.1	1659	UTR 3			NP_001313346.1
NM_001326418.1	1659	UTR 3			NP_001313347.1
NM_001326419.1	1659	UTR 3			NP_001313348.1
NM_001326420.1	1659	UTR 3			NP_001313349.1
NM_001326421.1	1659	UTR 3			NP_001313350.1
NM_014338.3	1659	UTR 3			NP_055153.1
NM_178022.1	1659	UTR 3			NP_821141.1

Gene

SFI1

Gene Name

SFI1 centrin binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001007467.2	1659	Intron			NP_001007468.1
NM_001258325.1	1659	Intron			NP_001245254.1
NM_001258326.1	1659	Intron			NP_001245255.1
NM_001258327.1	1659	Intron			NP_001245256.1
NM_014775.3	1659	Intron			NP_055590.2
XM_005261868.2	1659	Intron			XP_005261925.1
XM_006724390.2	1659	Intron			XP_006724453.1
XM_011530570.2	1659	Intron			XP_011528872.1
XM_011530571.2	1659	Intron			XP_011528873.1
XM_011530574.2	1659	Intron			XP_011528876.1
XM_011530575.2	1659	Intron			XP_011528877.1
XM_011530576.2	1659	Intron			XP_011528878.1
XM_011530577.2	1659	Intron			XP_011528879.1
XM_011530579.2	1659	Intron			XP_011528881.1
XM_011530580.2	1659	Intron			XP_011528882.1
XM_011530581.2	1659	Intron			XP_011528883.1
XM_011530582.2	1659	Intron			XP_011528884.1
XM_011530583.2	1659	Intron			XP_011528885.1
XM_011530587.2	1659	Intron			XP_011528889.1
XM_017029139.1	1659	Intron			XP_016884628.1
XM_017029140.1	1659	Intron			XP_016884629.1
XM_017029141.1	1659	Intron			XP_016884630.1
XM_017029142.1	1659	Intron			XP_016884631.1
XM_017029143.1	1659	Intron			XP_016884632.1
XM_017029144.1	1659	Intron			XP_016884633.1
XM_017029145.1	1659	Intron			XP_016884634.1
XM_017029146.1	1659	Intron			XP_016884635.1
XM_017029147.1	1659	Intron			XP_016884636.1
XM_017029148.1	1659	Intron			XP_016884637.1
XM_017029149.1	1659	Intron			XP_016884638.1
XM_017029150.1	1659	Intron			XP_016884639.1
XM_017029151.1	1659	Intron			XP_016884640.1
XM_017029152.1	1659	Intron			XP_016884641.1
XM_017029153.1	1659	Intron			XP_016884642.1
XM_017029154.1	1659	Intron			XP_016884643.1
XM_017029155.1	1659	Intron			XP_016884644.1
XM_017029156.1	1659	Intron			XP_016884645.1
XM_017029157.1	1659	Intron			XP_016884646.1
XM_017029158.1	1659	Intron			XP_016884647.1
XM_017029159.1	1659	Intron			XP_016884648.1
XM_017029160.1	1659	Intron			XP_016884649.1
XM_017029161.1	1659	Intron			XP_016884650.1
XM_017029162.1	1659	Intron			XP_016884651.1

View Full Product Details