Product Details

SNP ID: rs10241012
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.7:104334784 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTTATTACAGCATTGGGAGATAATC[A/G]TATCTCAGGCTTCAGCAAATTTTCC
Phenotype: MIM: 609719
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: LHFPL3 PubMed Links
Additional Information: For this assay, SNP(s) [rs79191684] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_199000.2		Intron			NP_945351.1
XM_005250327.1		Intron			XP_005250384.1