Product Details

SNP ID: rs366577
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:4951185 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: AACCTCCAGCGAAGACATCCCAGGT[C/T]GGGTGAATCTTCCAGCCCTGGGGGT
Phenotype: MIM: 131370 MIM: 176610 MIM: 610431 MIM: 610056
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ENO3 PubMed Links

Gene Details

Gene: ENO3
Gene Name: enolase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193503.1	500	Intron			NP_001180432.1
NM_001976.4	500	Intron			NP_001967.3
NM_053013.3	500	Intron			NP_443739.3
XM_005256521.2	500	Intron			XP_005256578.1
XM_011523729.1	500	Intron			XP_011522031.1
XM_017024346.1	500	UTR 5			XP_016879835.1

Gene: PFN1
Gene Name: profilin 1

There are no transcripts associated with this gene.

Gene: RNF167
Gene Name: ring finger protein 167

There are no transcripts associated with this gene.

Gene: SPAG7
Gene Name: sperm associated antigen 7

There are no transcripts associated with this gene.

View Full Product Details