Product Details

SNP ID: hCV2575706
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:4968438 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGAACAAATAAATAAGGCAAGTCA[G/T]GAGGGGGCCGAGTCGGGTGCAGGCA
Phenotype: MIM: 611508 MIM: 610056
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CAMTA2 PubMed Links

Gene Details

Gene: CAMTA2
Gene Name: calmodulin binding transcription activator 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001171166.1	4336	UTR 3			NP_001164637.1
NM_001171167.1	4336	UTR 3			NP_001164638.1
NM_001171168.1	4336	UTR 3			NP_001164639.1
NM_015099.3	4336	UTR 3			NP_055914.2

Gene: MIR6864
Gene Name: microRNA 6864

There are no transcripts associated with this gene.

Gene: MIR6865
Gene Name: microRNA 6865

There are no transcripts associated with this gene.

Gene: SPAG7
Gene Name: sperm associated antigen 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004890.2	4336	Intron			NP_004881.2

View Full Product Details