Product Details

SNP ID: rs8012627
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.14:73487792 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TCTTGAGATGAAGGAGATGGTAGCG[A/C]CTTTGGAGAGGAGATGGAATGTGAA
Phenotype: MIM: 614313 MIM: 611919
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ACOT1 PubMed Links

Gene Details

Gene: ACOT1
Gene Name: acyl-CoA thioesterase 1

There are no transcripts associated with this gene.

Gene: C14orf169
Gene Name: chromosome 14 open reading frame 169

There are no transcripts associated with this gene.

Gene: HEATR4
Gene Name: HEAT repeat containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001220484.1		Intron			NP_001207413.1
NM_203309.2		Intron			NP_976054.2
XM_006720143.2		Intron			XP_006720206.1
XM_011536760.2		Intron			XP_011535062.1
XM_011536761.2		Intron			XP_011535063.1
XM_017021289.1		Intron			XP_016876778.1

View Full Product Details