Product Details

SNP ID: rs12170331
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:17117519 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAGGCGGGGGCTTGGCCTGGGTGCT[A/G]AGTTAACGGCCAGTGACTTGGCACT
Phenotype: MIM: 605461
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CECR6 PubMed Links

Gene Details

Gene: CECR6
Gene Name: cat eye syndrome chromosome region, candidate 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163079.1	2741	UTR 3			NP_001156551.1
NM_031890.3	2741	UTR 3			NP_114096.1
XM_011546124.2	2741	Intron			XP_011544426.1
XM_011546125.2	2741	UTR 3			XP_011544427.1

Gene: IL17RA
Gene Name: interleukin 17 receptor A

There are no transcripts associated with this gene.

Gene: LOC100996342
Gene Name: uncharacterized LOC100996342

There are no transcripts associated with this gene.

View Full Product Details