Product Details

SNP ID: rs17552038
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:73950242 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTATTTCCGGTTCTGAGGACGCCGC[C/G]GAAGCGGGACGGGATTGGAGTGCTC
Phenotype: MIM: 614647 MIM: 603162
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: COQ6 PubMed Links

Gene Details

Gene: COQ6
Gene Name: coenzyme Q6, monooxygenase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_182476.2	173	Intron			NP_872282.1
NM_182480.2	173	Intron			NP_872286.2
XM_006720156.1	173	Intron			XP_006720219.1
XM_011536807.1	173	Intron			XP_011535109.1
XM_011536808.1	173	Intron			XP_011535110.1
XM_011536809.2	173	Intron			XP_011535111.1
XM_011536810.2	173	Intron			XP_011535112.1
XM_017021351.1	173	Intron			XP_016876840.1
XM_017021352.1	173	Intron			XP_016876841.1

Gene: ENTPD5
Gene Name: ectonucleoside triphosphate diphosphohydrolase 5

There are no transcripts associated with this gene.

Gene: FAM161B
Gene Name: family with sequence similarity 161 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_152445.2	173	UTR 5			NP_689658.2
XM_011536475.1	173	Intron			XP_011534777.1

View Full Product Details