Product Details

SNP ID: rs3741259
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:61514878 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCACCTCAGGGACCAGGAAGGAGG[C/T]GCTGGCCTGAAACTACAGTGGCCCC
Phenotype: MIM: 604146
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: LRRC10B PubMed Links

Gene Details

Gene: LRRC10B
Gene Name: leucine rich repeat containing 10B

There are no transcripts associated with this gene.

Gene: MIR4488
Gene Name: microRNA 4488

There are no transcripts associated with this gene.

Gene: SYT7
Gene Name: synaptotagmin 7

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001252065.1	5238	UTR 3			NP_001238994.1
NM_001300773.1	5238	UTR 3			NP_001287702.1
NM_004200.3	5238	UTR 3			NP_004191.2
XM_005274383.4	5238	Intron			XP_005274440.1
XM_005274384.2	5238	Intron			XP_005274441.1
XM_005274385.4	5238	Intron			XP_005274442.1
XM_005274387.4	5238	Intron			XP_005274444.1
XM_005274390.4	5238	Intron			XP_005274447.1
XM_006718736.3	5238	Intron			XP_006718799.1
XM_011545335.2	5238	Intron			XP_011543637.1
XM_011545336.2	5238	Intron			XP_011543638.1
XM_011545337.2	5238	Intron			XP_011543639.1
XM_011545338.2	5238	Intron			XP_011543640.1
XM_011545339.2	5238	Intron			XP_011543641.1
XM_011545340.2	5238	Intron			XP_011543642.1
XM_011545341.2	5238	Intron			XP_011543643.1
XM_011545342.2	5238	Intron			XP_011543644.1
XM_011545343.2	5238	Intron			XP_011543645.1

View Full Product Details