Product Details

SNP ID: rs1500482
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:233774392 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AATGAGGAACACGGCTGTTGGGTGC[C/T]TGAGTACTTGCCTCGTCAGGGATTG
Phenotype: MIM: 191740 MIM: 606435 MIM: 606428 MIM: 606429 MIM: 606430 MIM: 606431 MIM: 606432 MIM: 606433 MIM: 606434
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MROH2A PubMed Links

Gene Details

Gene: MROH2A
Gene Name: maestro heat like repeat family member 2A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001287395.1	371	Intron			NP_001274324.1
XM_011511075.2	371	Intron			XP_011509377.1
XM_011511076.2	371	Intron			XP_011509378.1
XM_011511077.2	371	Intron			XP_011509379.1
XM_011511078.2	371	Intron			XP_011509380.1
XM_011511079.2	371	Intron			XP_011509381.1
XM_011511080.2	371	UTR 5			XP_011509382.1
XM_011511081.2	371	Intron			XP_011509383.1
XM_011511082.2	371	Intron			XP_011509384.1
XM_011511083.2	371	Intron			XP_011509385.1
XM_011511084.2	371	Intron			XP_011509386.1
XM_011511085.2	371	Intron			XP_011509387.1
XM_011511086.2	371	Intron			XP_011509388.1

Gene: UGT1A1
Gene Name: UDP glucuronosyltransferase family 1 member A1

There are no transcripts associated with this gene.

Gene: UGT1A10
Gene Name: UDP glucuronosyltransferase family 1 member A10

There are no transcripts associated with this gene.

Gene: UGT1A3
Gene Name: UDP glucuronosyltransferase family 1 member A3

There are no transcripts associated with this gene.

Gene: UGT1A4
Gene Name: UDP glucuronosyltransferase family 1 member A4

There are no transcripts associated with this gene.

Gene: UGT1A5
Gene Name: UDP glucuronosyltransferase family 1 member A5

There are no transcripts associated with this gene.

Gene: UGT1A6
Gene Name: UDP glucuronosyltransferase family 1 member A6

There are no transcripts associated with this gene.

Gene: UGT1A7
Gene Name: UDP glucuronosyltransferase family 1 member A7

There are no transcripts associated with this gene.

Gene: UGT1A8
Gene Name: UDP glucuronosyltransferase family 1 member A8

There are no transcripts associated with this gene.

Gene: UGT1A9
Gene Name: UDP glucuronosyltransferase family 1 member A9

There are no transcripts associated with this gene.

View Full Product Details