Product Details

SNP ID: rs11849590
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.14:75578902 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCCTTTCAACTCTAAGAGACCAG[C/T]AGAGGCCACTGTCCCTTAAGACTGC
Phenotype: MIM: 610865
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: FLVCR2 PubMed Links
Additional Information: For this assay, SNP(s) [rs148092740] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: FLVCR2
Gene Name: feline leukemia virus subgroup C cellular receptor family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001195283.1	306	Intron			NP_001182212.1
NM_017791.2	306	UTR 5			NP_060261.2

There are no transcripts associated with this gene.