Product Details

SNP ID: rs3746348
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:63555834 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGAGTTCCTGACCTCGGACCTGAG[C/T]CCGCACCTGCTCAAGCGCCACCACG
Phenotype: MIM: 611265
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FNDC11 PubMed Links

Gene Details

Gene: FNDC11
Gene Name: fibronectin type III domain containing 11

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001319152.1	247	Silent Mutation	AGC,AGT	S57S	NP_001306081.1
NM_001319153.1	247	Silent Mutation	AGC,AGT	S57S	NP_001306082.1
NM_024059.3	247	Silent Mutation	AGC,AGT	S57S	NP_076964.1
XM_011529041.2	247	Silent Mutation	AGC,AGT	S57S	XP_011527343.1
XM_017028060.1	247	Silent Mutation	AGC,AGT	S62S	XP_016883549.1

Gene: HELZ2
Gene Name: helicase with zinc finger 2

There are no transcripts associated with this gene.

Gene: SRMS
Gene Name: src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites

There are no transcripts associated with this gene.

View Full Product Details