Product Details

SNP ID: rs632111
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:48705721 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATTTGTAACCATTACACAGTCATCA[A/G]AGGAATAATTTTTTTTAATCACCAG
Phenotype: MIM: 182100 MIM: 610349
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FUT2 PubMed Links

Gene Details

Gene: FUT2
Gene Name: fucosyltransferase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000511.5	2934	Intron			NP_000502.4
NM_001097638.2	2934	Intron			NP_001091107.1

Gene: LOC105447645
Gene Name: uncharacterized LOC105447645

There are no transcripts associated with this gene.

Gene: MAMSTR
Gene Name: MEF2 activating motif and SAP domain containing transcriptional regulator

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130915.1	2934	Intron			NP_001124387.1
NM_001297753.1	2934	Intron			NP_001284682.1
NM_182574.2	2934	Intron			NP_872380.1
XM_011526807.2	2934	Intron			XP_011525109.1
XM_011526808.2	2934	Intron			XP_011525110.1
XM_011526809.2	2934	Intron			XP_011525111.1
XM_017026640.1	2934	Intron			XP_016882129.1
XM_017026641.1	2934	Intron			XP_016882130.1
XM_017026642.1	2934	UTR 3			XP_016882131.1
XM_017026643.1	2934	Intron			XP_016882132.1
XM_017026644.1	2934	Intron			XP_016882133.1
XM_017026645.1	2934	Intron			XP_016882134.1

View Full Product Details