Product Details

SNP ID: rs2077543
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.15:41840002 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGGCAGGCGTCATGATGGAGATAT[C/G]ATGTCTCCTCTTGTTGATTCAGGAT
Phenotype: MIM: 606088 MIM: 605916
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: JMJD7 PubMed Links

Gene Details

Gene: JMJD7
Gene Name: jumonji domain containing 7

There are no transcripts associated with this gene.

Gene: JMJD7-PLA2G4B
Gene Name: JMJD7-PLA2G4B readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198588.1		Intron			NP_001185517.1
NM_005090.3		Intron			NP_005081.1

Gene: PLA2G4B
Gene Name: phospholipase A2 group IVB

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001114633.1		Intron			NP_001108105.1

Gene: SPTBN5
Gene Name: spectrin beta, non-erythrocytic 5

There are no transcripts associated with this gene.

View Full Product Details