Product Details

SNP ID: rs36655
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:54162234 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCACCTCGTCGGGCACCTGGAACTC[C/T]TGGGTCCCCGCCAGACGACCCAGCG
Phenotype: MIM: 604910
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CNOT3 PubMed Links

Gene Details

Gene: CNOT3
Gene Name: CCR4-NOT transcription complex subunit 3

There are no transcripts associated with this gene.

Gene: LENG1
Gene Name: leukocyte receptor cluster member 1

There are no transcripts associated with this gene.

Gene: TMC4
Gene Name: transmembrane channel like 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145303.2	1190	Silent Mutation	CAA,CAG	Q524Q	NP_001138775.2
NM_144686.3	1190	Silent Mutation	CAA,CAG	Q518Q	NP_653287.2
XM_011526486.2	1190	Silent Mutation	CAA,CAG	Q364Q	XP_011524788.1

View Full Product Details