Product Details

SNP ID: rs575123
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:60927829 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCGGCTCCATGCCACACACCCTGC[A/C]GGCACTGCTCACCAAGCCTGCCGCT
Phenotype: MIM: 610408
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: SLC15A3 PubMed Links

Gene Details

Gene: SLC15A3
Gene Name: solute carrier family 15 member 3

There are no transcripts associated with this gene.

Gene: TMEM109
Gene Name: transmembrane protein 109

There are no transcripts associated with this gene.

Gene: TMEM132A
Gene Name: transmembrane protein 132A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017870.3	697	Silent Mutation	GCA,GCC	A168A	NP_060340.2
NM_178031.2	697	Silent Mutation	GCA,GCC	A168A	NP_821174.1
XM_017017951.1	697	Silent Mutation	GCA,GCC	A181A	XP_016873440.1
XM_017017952.1	697	Silent Mutation	GCA,GCC	A181A	XP_016873441.1

View Full Product Details