Product Details

SNP ID: rs6062683
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.20:64260534 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTGTGCTGCCACAGCCTGTACTGC[A/G]CACCTGCCCTCTGGACAGCGGAGGA
Phenotype
Polymorphism: A/G, Transition Substitution
Allele Nomenclature
Literature Links: PCMTD2 PubMed Links
Additional Information: For this assay, SNP(s) [rs76879965] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene: PCMTD2
Gene Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001104925.1		Intron			NP_001098395.1
NM_018257.2		Intron			NP_060727.2